Sequence ID | >SRA1043391 |
Genome ID | SRR035092.106486 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 123 |
End posion on genome | 50 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gatctactaT |
tRNA gene sequence |
AGGATCGTGGCTTAATGGTAGAGCATCGCCCTGATATGGCGAAGACCGCAAGTTCGATTC |
Downstream region at tRNA end position |
gagcttatag |
Secondary structure (Cloverleaf model) | >SRA1043391 Ile GAT T ATac gagcttatag A - T G - C G - C A - T T + G C - G G - C T T T C G T T C A A A G | | | | | G T T T C G G C A A G C G + | | | T T G G A G C T A A AGACC T - A C - G G - C C - G C - G C T T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |