Sequence ID | >SRA1043425 |
Genome ID | SRR035092.112544 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 276 |
End posion on genome | 205 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aatataagat |
tRNA gene sequence |
GCGGCCATAGTTTAGTGGTAAAACGGCACGTTGCCAACGTACAGATCGGAGTTCGATTCT |
Downstream region at tRNA end position |
aaaagtaaat |
Secondary structure (Cloverleaf model) | >SRA1043425 Gly GCC t ACac aaaagtaaat G - C C - G G - C G - C C - G C - G A - T T T T G C C T C A G A A | | | | | G T T T T G C G G A G C G | | | | T T G A A A C T A G AGAT G - C C A A - T C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |