Sequence ID | >SRA1043471 |
Genome ID | SRR035092.121077 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 149 |
End posion on genome | 77 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aatctactaa |
tRNA gene sequence |
CCGAAGGAAGCCAAATGGCCAGGCAACGGACTGTAAACCCGTAATTTGTTGGTTCGATTC |
Downstream region at tRNA end position |
ttggtataat |
Secondary structure (Cloverleaf model) | >SRA1043471 Tyr GTA a ACat ttggtataat C - G C - G G - C A - T A - T G + T G - C T T A C A A C C A A A A | | | | | G T A C C G G T T G G C G | | | T T G A G G C C C A AATTT A - T C - G G - C G - C A C C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |