Sequence ID | >SRA1043657 |
Genome ID | SRR035092.155941 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 379 |
End posion on genome | 303 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gataaaaatg |
tRNA gene sequence |
GTGGCTATAGCTCAATTGGTAGAGCTCCAGATTGTGGTTCTGGCGGTTTGAGGGTTCAAA |
Downstream region at tRNA end position |
ggataaaaat |
Secondary structure (Cloverleaf model) | >SRA1043657 His GTG g CCCA ggataaaaat G - C T - A G - C G - C C - G T - A A - T T A T C T C C C A T A A A | | | | | A T C T C G G A G G G C G | | | | T T G G A G C T A T CGGTTT C - G C - G A - T G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |