Sequence ID | >SRA1043697 |
Genome ID | SRR035092.162164 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 172 |
End posion on genome | 248 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
caaacacgaT |
tRNA gene sequence |
GGCTTCGTAGCTCAGCCTGGTTAGAGCACTGGACTTTTAATCCAGGTGTCGAGGGTTCAA |
Downstream region at tRNA end position |
ttttatttat |
Secondary structure (Cloverleaf model) | >SRA1043697 Lys TTT T ATtt ttttatttat G - C G - C C - G T + G T + G C - G G - C T A T T T C C C A C C G A A + | | | | A T C T C G G A G G G C G | | | | T T G G A G C T T A A GTGTC C - G T - A G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |