Sequence ID | >SRA1043699 |
Genome ID | SRR035092.162300 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 263 |
End posion on genome | 334 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
attgtcgtag |
tRNA gene sequence |
GCGAGTATGGTGTTAACGGTAACATAAGGGATTTCCAATCCTTTGTTGTGGGTTCGAATC |
Downstream region at tRNA end position |
ggagtatagt |
Secondary structure (Cloverleaf model) | >SRA1043699 Gly TCC g Atag ggagtatagt G - C C - G G - C A - T G - C T - A A - T T A T C G T C C A A A T G | + + | | G C T G T G G T G G G C G | | | + T T G A C A T T A A TGTT A - T G + T G - C G - C A - T T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |