| Sequence ID | >SRA1043713 |
| Genome ID | SRR035092.163976 |
| Phylum/Class | 454 Sequencing (SRP001813) |
| Species | |
| Start position on genome | 301 |
| End posion on genome | 374 |
| Amino Acid | Gln |
| Anticodon | TTG |
| Upstream region at tRNA start position |
gtcacccaat |
| tRNA gene sequence |
AGCCCTGTCGTCCAACCGGTTAGGACTTCAGACTTTGATTCTGACAATTGCGGTTCAAGT |
| Downstream region at tRNA end position |
gacaactgca |
| Secondary structure (Cloverleaf model) | >SRA1043713 Gln TTG
t GCtt gacaactgca
A - T
G + T
C - G
C - G
C - G
T + G
G - C T G
T A T G C C A
C A A C | + | | | A
C C C T G T G C G G C
G | | | | T T
G G G A C
T T A T CAAT
T - A
C - G
A - T
G - C
A - T
C T
T A
T T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |