Sequence ID | >SRA1043740 |
Genome ID | SRR035092.167622 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 304 |
End posion on genome | 220 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
aaaagcgtta |
tRNA gene sequence |
GGAAGAATCGCATAATGGCATTGCAACAGATTGCTAATCTGTGAGTGTAAAAGCTCTCTG |
Downstream region at tRNA end position |
aggaaggata |
Secondary structure (Cloverleaf model) | >SRA1043740 Ser GCT a GCCA aggaaggata G - C G - C A - T A - T G - C A - T A - T T T T G A C C C A A A C | | | | | G T T A C G C T G G G C G | | | T T G T T G C C A A GAGTGTAAAAGCTCT A - T C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |