Sequence ID | >SRA1043776 |
Genome ID | SRR035092.173349 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 143 |
End posion on genome | 61 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ttgatttcca |
tRNA gene sequence |
GGAAGGTTGTCCCGAATGGTAAGGGTCCAGATTGCTAATCTGGTGTCGGTAACGGCATAA |
Downstream region at tRNA end position |
aattgagtca |
Secondary structure (Cloverleaf model) | >SRA1043776 Ser GCT a Gtct aattgagtca G - C G - C A - T A - T G - C G - C T - A T A T T T C C C A A A G G | | | | | G T C C C T A A G G G C G | | + T T G A G G G T A T TGTCGGTAACGGCAT C - G C - G A - T G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |