Sequence ID | >SRA1043788 |
Genome ID | SRR035092.175778 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 195 |
End posion on genome | 121 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
ctaactaaga |
tRNA gene sequence |
GCGTCCGTAGCTCAATTGGTTAGAGCACCAAGCTTATACCTTGGCGGTTCTAGGTTCGAG |
Downstream region at tRNA end position |
tttttatgta |
Secondary structure (Cloverleaf model) | >SRA1043788 Ile TAT a ACtt tttttatgta G - C C - G G - C T - A C - G C - G G - C T G T G A T C C A T A A A | | | | | G T C T C G C T A G G C G | | | | T T G G A G C T T A A CGGTT C - G C - G A - T A - T G - C C C T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |