Sequence ID | >SRA1043806 |
Genome ID | SRR035092.178927 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 296 |
End posion on genome | 369 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cggttaatta |
tRNA gene sequence |
TTGGGAGTAGCCAAGTGGTAAGGCAGCGGCCTTTGGCGCCGTGATCGTAGGTTCGAATCC |
Downstream region at tRNA end position |
tgatttttat |
Secondary structure (Cloverleaf model) | >SRA1043806 Gln TTG a GCTA tgatttttat T - A T C G - C G - C G - C A - T G - C T A T C T T C C A G A A | | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GATC G + T C - G G - C G - C C - G C C T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |