Sequence ID | >SRA1043852 |
Genome ID | SRR035092.185893 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 435 |
End posion on genome | 351 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctttttatac |
tRNA gene sequence |
GCAGGTGTGCCGGAGCGGTCAAACGGGACAGACTCAAAATCTGTTTGGGCTTATGCCTAC |
Downstream region at tRNA end position |
taagtccgaa |
Secondary structure (Cloverleaf model) | >SRA1043852 Leu CAA c Attt taagtccgaa G - C C - G A - T G - C G - C T - A G - C C A T T T T C C A C G A G + | | | | G G G G C C G A A G G C G | | | T T T A C G G C A A G TTGGGCTTATGCCTAC A - T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |