Sequence ID | >SRA1043882 |
Genome ID | SRR035092.190277 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 122 |
End posion on genome | 47 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
atgccagtga |
tRNA gene sequence |
GCCCCCGTAGTTCAACGGATAGAACACGCCCCTCCTAAGGGTGAAAATGCAGGTTCGATT |
Downstream region at tRNA end position |
ggtacagaat |
Secondary structure (Cloverleaf model) | >SRA1043882 Arg CCT a ACCA ggtacagaat G + T C - G C - G C - G C - G C - G G - C T T T C G C C C A C A A A | | | | G G C T T G G C A G G C G | | | | T T A G A A C T A A AAAAT C - G G + T C - G C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |