Sequence ID | >SRA1044003 |
Genome ID | SRR035092.208534 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 141 |
End posion on genome | 67 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
aattaaatat |
tRNA gene sequence |
GCCGAAGTAGCTCATCGGTAGAGCGTTCGCCTGAAAAGCGATGCGTAGTGAGTTCGACTC |
Downstream region at tRNA end position |
tccatccttc |
Secondary structure (Cloverleaf model) | >SRA1044003 Phe GAA t ACCA tccatccttc G - C C - G C - G G - C A - T A - T G - C T C T C A C T C A T A A | | | | | G C C T C G G T G A G C G | | | | T T G G A G C T A G GCGTA T T T - A C - G G - C C - G C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |