Sequence ID | >SRA1044081 |
Genome ID | SRR035092.221292 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 210 |
End posion on genome | 298 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tggcccgaaT |
tRNA gene sequence |
AGTGGGTTGTCCGAGTCTGGTTAATGGTAACGGTCTTGAAAACCGTTGTGTAGAGATGCA |
Downstream region at tRNA end position |
gcggacttag |
Secondary structure (Cloverleaf model) | >SRA1044081 Ser TGA T GAaa gcggacttag A - T G - C T - A G - C G - C G - C T - A T A T C T C C C A C T G A G | + | | | G T G C C T G G G G G C G + | | T T G T G G T T T A A A TGTGTAGAGATGCACC A - T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |