Sequence ID | >SRA1044125 |
Genome ID | SRR035092.227865 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 190 |
End posion on genome | 107 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
gtagttttac |
tRNA gene sequence |
GCGAGGGTGCCGGAGTGGTCAAACGGGCTGCCCTTAAGAGGCAGTAGCTTAGTGCTTGCG |
Downstream region at tRNA end position |
atggttgtaa |
Secondary structure (Cloverleaf model) | >SRA1044125 Leu TAA c Atat atggttgtaa G - C C - G G - C A - T G - C G - C G - C T A T T G T C C A T G A G + | | | | A G G G C C G C A G G C G | | | T T T A C G G C A A G TAGCTTAGTGCTTGC C - G T - A G - C C - G C - G C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |