Sequence ID | >SRA1044212 |
Genome ID | SRR035092.242254 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 82 |
End posion on genome | 166 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttgattataa |
tRNA gene sequence |
GCCGCGGTGGCGGAATTTGGTATACGCGCATGGTTCAGAACCATGTGGGTGCAAGCCCTT |
Downstream region at tRNA end position |
ttaataaaat |
Secondary structure (Cloverleaf model) | >SRA1044212 Leu CAG a Atta ttaataaaat G - C C - G C - G G - C C - G G - C G - C T G T C T C T C A T T A A G | | | | | A T G G C G G A G A G C G | | | T T G A C G C T A T G TGGGTGCAAGCCCTT C - G A - T T - A G - C G - C T A T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |