Sequence ID | >SRA1044291 |
Genome ID | SRR035092.253991 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 326 |
End posion on genome | 252 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
attataatac |
tRNA gene sequence |
GCCAGCATAGCTCAGTGGTAGAGCAGGGCTTTCGTAAAGTTCAGGTCGGGGGTTCGACTC |
Downstream region at tRNA end position |
tttacttgaa |
Secondary structure (Cloverleaf model) | >SRA1044291 Thr CGT c TCCA tttacttgaa G - C C - G C - G A - T G - C C - G A - T T C T C T C C C A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G - C G + T G + T C - G T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |