Sequence ID | >SRA1044314 |
Genome ID | SRR035092.257680 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 278 |
End posion on genome | 204 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttttaaatat |
tRNA gene sequence |
GGGGTCGTAGGGTAATGGTAGCCCGTCTGGTTGTGGCCCAGGAAGAGCGCGGTTCGAATC |
Downstream region at tRNA end position |
tattaataaa |
Secondary structure (Cloverleaf model) | >SRA1044314 His GTG t TCCA tattaataaa G - C G - C G - C G + T T - A C - G G - C T A T C C G C C A A A A | | | | G T T G G G C G C G G C G + | | | T T G G C C C T A G AAGAG T + G C - G T - A G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |