Sequence ID | >SRA1044332 |
Genome ID | SRR035092.261347 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 510 |
End posion on genome | 581 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
taaatatccg |
tRNA gene sequence |
GGGCTCATAGTAAAACGGTATTACACAGCATTCGCATTGCTGAAGTCCGGGTTCAATTCC |
Downstream region at tRNA end position |
tgatttgnnn |
Secondary structure (Cloverleaf model) | >SRA1044332 Ala CGC g ACtt tgatttgnnn G - C G - C G + T C - G T - A C - G A - T T T T G G C C C A A A A | | | | | A C A A T G C C G G G C G | | | | T T G T T A C T A A AAGT C - G A - T G - C C - G A - T T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |