Sequence ID | >SRA1044367 |
Genome ID | SRR035092.267161 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 120 |
End posion on genome | 197 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggcgccatac |
tRNA gene sequence |
CTCCCTGTCGCCTAACTGGATATGGCAACACGCTTCTAACGTGTAACAATGAGGGTTCGA |
Downstream region at tRNA end position |
tatagccgat |
Secondary structure (Cloverleaf model) | >SRA1044367 Arg TCT c GCCA tatagccgat C - G T - A C - G C - G C - G T + G G + T T A T C T T C C A C A A C | | + | | G T T C C G G A G G G C G | | | T T G T G G C A T A A AACAAT A - T C - G A - T C - G G - C C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |