Sequence ID | >SRA1044369 |
Genome ID | SRR035092.267165 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 235 |
End posion on genome | 161 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggaaaattat |
tRNA gene sequence |
GCTGAGATAGCTCAGTTGGTCAGAGCAACAGTTTTGTAAACTGTAGGTCCCGGGTTCGAA |
Downstream region at tRNA end position |
agagggcaag |
Secondary structure (Cloverleaf model) | >SRA1044369 Thr TGT t TCat agagggcaag G - C C - G T - A G - C A - T G - C A - T T A T G G C C C A T G A A | | | | | G T C T C G C C G G G C G | | | | T T G G A G C T C A A AGGTC A - T C - G A - T G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |