Sequence ID | >SRA1044409 |
Genome ID | SRR035092.275344 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 77 |
End posion on genome | 152 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gaagcaccaa |
tRNA gene sequence |
GGGTTGTTAGCTCAGTTGGTAGAGCAGTCGCCTTTTAAGCGAAAGGTCCAGAGTTCAATC |
Downstream region at tRNA end position |
agggcgtatc |
Secondary structure (Cloverleaf model) | >SRA1044409 Lys TTT a ACCA agggcgtatc G - C G - C G - C T - A T - A G - C T - A C T T G T C T C A T G A A | | | | | A T C T C G C A G A G C G | | | | T T G G A G C T A A AGGTC G A T - A C - G G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |