Sequence ID | >SRA1044467 |
Genome ID | SRR035092.285319 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 261 |
End posion on genome | 183 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
ctaccggcac |
tRNA gene sequence |
TTGCCTATAGCCCAACTGGATAGGGCGCGCGGCTGCGAACCGCGTACTTTTCTCAGTTCA |
Downstream region at tRNA end position |
gttcattatc |
Secondary structure (Cloverleaf model) | >SRA1044467 Arg GCG c ACAA gttcattatc T - A T - A G - C C - G C - G T - A A - T T A T G A G T C A C A A A | | | | | A T C C C G C T C A G C G | | | | T T G G G G C A T A G TACTTTT C - G G - C C - G G - C G - C C A T A G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |