Sequence ID | >SRA1044556 |
Genome ID | SRR035092.300774 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 186 |
End posion on genome | 97 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tattcagttt |
tRNA gene sequence |
GGTGGGATGCCGGAGTGGCTAAACGGCCCAGTCTTGAAAACTGTGGAGGATGTAAGTTCT |
Downstream region at tRNA end position |
gtgaaaaaat |
Secondary structure (Cloverleaf model) | >SRA1044556 Ser TGA t GCAA gtgaaaaaat G - C G - C T - A G - C G - C G - C A - T T A T C A C C C A T G A G | | | | | G G G G C C G T G G G C G | | | T T C A C G G T A A C GGAGGATGTAAGTTCTAC C T C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |