Sequence ID | >SRA1044557 |
Genome ID | SRR035092.301203 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 250 |
End posion on genome | 322 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tatttaatta |
tRNA gene sequence |
GCGGTAGTAGCTTAGTGGTAGAGCGTCTGCTTCCCAAGCAGAAGATCGCGGGTTCGACTC |
Downstream region at tRNA end position |
tgttcgtggc |
Secondary structure (Cloverleaf model) | >SRA1044557 Gly CCC a TCtt tgttcgtggc G - C C - G G - C G - C T - A A - T G - C T C T T G C C C A G A A + | | | | G T T T C G G C G G G C G + | | | T T G G A G C T A G AGATC T - A C - G T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |