Sequence ID | >WENV031368 |
Genome ID | AACY021360589 |
Search identical group | |
Phylum/Class | Marine microbial communities from Global Ocean Sampling (GOS) |
Species | |
Start position on genome | 250 |
End posion on genome | 341 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgaccaaatT |
tRNA gene sequence |
GGTGAGCTGGCTGAGTGGCTGAAGGCGCACGCCTGGAAAGTGTGTTTAGGTTAATCCCTA |
Downstream region at tRNA end position |
Aatatgaaaa |
Secondary structure (Cloverleaf model) | >WENV031368 Ser GGA T GCCA Aatatgaaaa G - C G - C T - A G - C A - T G - C C - G T A T C T C T C A T G A G | | | | | G G G T C G G A G A G C G + | | T T C A G G C T G A G TTTAGGTTAATCCCTAAC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |