| Sequence ID | >SRA1044805 |
| Genome ID | SRR035092.348268 |
| Phylum/Class | 454 Sequencing (SRP001813) |
| Species | |
| Start position on genome | 283 |
| End posion on genome | 212 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
ctttcttttt |
| tRNA gene sequence |
GCGCCTGTAGCTCAGCGGTAGAGCGCCACGTTGCCAACGTNAAGGTCATGAGTTCGATCC |
| Downstream region at tRNA end position |
aaaagtcgat |
| Secondary structure (Cloverleaf model) | >SRA1044805 Gly GCC
t Tttg aaaagtcgat
G - C
C - G
G - C
C - G
C - G
T - A
G + T C T
T T A C T C A
G A A | | | | | G
C C T C G A T G A G C
G | | | | T T
G G A G C
T A G AGGTC
C A
C N
A - T
C - G
G - C
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |