Sequence ID | >SRA1044820 |
Genome ID | SRR035092.351933 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 106 |
End posion on genome | 182 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tatgtgttta |
tRNA gene sequence |
GCACGCGTGGCTCAGGTGGTTAGAGCGCGTCTCTGATAAAGACGAGGTCCCTGGTTCGAG |
Downstream region at tRNA end position |
attaggttct |
Secondary structure (Cloverleaf model) | >SRA1044820 Ile GAT a ACCC attaggttct G - C C - G A - T C - G G - C C - G G - C T G T G G A C C A G G A G | | | | | G T C T C G C C T G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C T - A C - G T - A C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |