Sequence ID | >SRA1044839 |
Genome ID | SRR035092.354917 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 56 |
End posion on genome | 132 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
tattgaatgt |
tRNA gene sequence |
GCGAGAGTAGCTCAGCTGGCTAGAGCATCTCCCTTCCAAGGAGAGGGTCGCGGGTTCGAA |
Downstream region at tRNA end position |
acgaaatgtt |
Secondary structure (Cloverleaf model) | >SRA1044839 Gly TCC t TCCA acgaaatgtt G - C C - G G - C A - T G - C A - T G - C T A T T G C C C A C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C C T A A GGGTC T - A C - G T - A C - G C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |