Sequence ID | >SRA1044888 |
Genome ID | SRR035092.367196 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 377 |
End posion on genome | 290 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcctctcccc |
tRNA gene sequence |
GGGATGGTACGCGAGTTGGTATAGCGGGGGCACTCAAAATGCCTTGGGCCTTTGGCCGTT |
Downstream region at tRNA end position |
tttccagaaa |
Secondary structure (Cloverleaf model) | >SRA1044888 Leu CAA c ACCA tttccagaaa G - C G - C G - C A - T T - A G + T G - C T C T C T C C C A T G A A | | | | | G T G C G C G A G G G C G | | | T T G A G C G T A T G TGGGCCTTTGGCCGTT G + T G - C G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |