Sequence ID | >SRA1044975 |
Genome ID | SRR035092.383687 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 223 |
End posion on genome | 313 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
taatattatt |
tRNA gene sequence |
GCGAGAATCGCATAGTCAGGTTGATTGCCCCAGATTTCCAATCTGGTCAGATAATGTCAC |
Downstream region at tRNA end position |
aatatgttct |
Secondary structure (Cloverleaf model) | >SRA1044975 Gly TCC t TCTA aatatgttct G - C C - G G - C A - T G - C A - T A - T T A T C T C C C A C T G A C | | | | G A T A C G G T G G G C G | | | T T G T T G C T T G A C TCAGATAATGTCACATC C - G C - G A - T G - C A - T T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |