Sequence ID | >SRA1045004 |
Genome ID | SRR035092.390769 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 283 |
End posion on genome | 213 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ctccatttgt |
tRNA gene sequence |
GCATCTATGTCCGATTGGCAAGGTGTCCGGTTGCAACCCGGAATATGTAGGTTCAATTCC |
Downstream region at tRNA end position |
tcgccgtctc |
Secondary structure (Cloverleaf model) | >SRA1045004 Cys GCA t Tgag tcgccgtctc G - C C - G A - T T - A C - G T + G A - T T T T C A T C C A T A G | | | | | A T G C C T G T A G G C G | | T T G A G G T C A G ATAT T - A C - G C - G G - C G - C T C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |