Sequence ID | >SRA1045067 |
Genome ID | SRR035092.404878 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001813) |
Species | |
Start position on genome | 33 |
End posion on genome | 108 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gacgcacaaa |
tRNA gene sequence |
GCTGAGATAGCCAAGTTGGTCACGGCGGGAGTCTGAAAAACTTCAGATGTCAGTTCGATT |
Downstream region at tRNA end position |
aagtatagcg |
Secondary structure (Cloverleaf model) | >SRA1045067 Phe GAA a ACAA aagtatagcg G - C C - G T - A G - C A - T G - C A - T T T T C A G T C A T G A A | | | | | G T A C C G G T C A G C G | | | T T G C G G C T C A G AGAT G - C G + T A - T G - C T - A C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |