| Sequence ID | >SRA1045084 |
| Genome ID | SRR035092.407219 |
| Phylum/Class | 454 Sequencing (SRP001813) |
| Species | |
| Start position on genome | 267 |
| End posion on genome | 190 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
aatacattat |
| tRNA gene sequence |
CTGCCCTTAGCTCAGCTGGATAAGAGCAAGTGCCTTCTAAGCACTAGGTCGGGGGTTCGA |
| Downstream region at tRNA end position |
atttaagtat |
| Secondary structure (Cloverleaf model) | >SRA1045084 Arg TCT
t GCCA atttaagtat
C - G
T - A
G - C
C - G
C A
C - G
T C T A
T C T C C C A
T C G A A | + | | | G
G C T C G G G G G G C
G | | | | T T
A G A G C
T A A A AGGTC
A - T
G - C
T - A
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |