Sequence ID | >SRA1045271 |
Genome ID | SRR035093.48639 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001814) |
Species | |
Start position on genome | 240 |
End posion on genome | 314 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tattaatttt |
tRNA gene sequence |
GGTTTCGTGGTGAAATGGATATCATTCAAGGTTTCGACCCTTGCGTTTCAGGTTCGAGTC |
Downstream region at tRNA end position |
gtttctagtt |
Secondary structure (Cloverleaf model) | >SRA1045271 Arg TCG t GCCA gtttctagtt G - C G + T T - A T + G T - A C - G G - C T G T A G T C C A T A A G | | | | | G G A G T G T C A G G C G | | | + T T A T C A T T A T CGTT C - G A - T A - T G - C G - C T C T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |