| Sequence ID | >SRA1045404 |
| Genome ID | SRR035093.86401 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 483 |
| End posion on genome | 408 |
| Amino Acid | Sup |
| Anticodon | TTA |
| Upstream region at tRNA start position |
ggtcagaaat |
| tRNA gene sequence |
GGCTCTTTAGCTCAGTTGGTTAGAGCAACGGACTTTAAATCCGTGGTCACGAGTTCGAGT |
| Downstream region at tRNA end position |
cttttttcat |
| Secondary structure (Cloverleaf model) | >SRA1045404 Sup TTA
t ACAA cttttttcat
G - C
G + T
C - G
T - A
C - G
T + G
T - A T G
T T G C T C A
T G A A | | | | | G
T C T C G A C G A G C
G | | | | T T
G G A G C
T T A A GGTC
A - T
C - G
G - C
G - C
A - T
C A
T A
T T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |