Sequence ID | >SRA1045774 |
Genome ID | SRR035093.166396 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001814) |
Species | |
Start position on genome | 335 |
End posion on genome | 406 |
Amino Acid | Thr |
Anticodon | AGT |
Upstream region at tRNA start position |
ctcagcattc |
tRNA gene sequence |
GCACTCATAGCTCAGTGGTAGAGCGCAAGCTTAGTAAGCTTGAGGTCAGGGGTTCGAAAC |
Downstream region at tRNA end position |
tataaaaaaa |
Secondary structure (Cloverleaf model) | >SRA1045774 Thr AGT c Aaac tataaaaaaa G - C C - G A - T C - G T - A C - G A - T A A T T T C C C A G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C T A G AGGTC C - G A - T A - T G - C C - G T A T A A G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |