| Sequence ID | >SRA1046057 |
| Genome ID | SRR035093.225777 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 220 |
| End posion on genome | 147 |
| Amino Acid | Thr |
| Anticodon | AGT |
| Upstream region at tRNA start position |
gtggtgaccT |
| tRNA gene sequence |
GCATTCATAGCTCAGTGGTAGAGCGCAAGCTTAGTAAGCTTGAGGTCAGGGGTTCGAAAC |
| Downstream region at tRNA end position |
tccattcttt |
| Secondary structure (Cloverleaf model) | >SRA1046057 Thr AGT
T AAtt tccattcttt
G + T
C - G
A - T
T + G
T - A
C - G
A - T A A
T T T C C C A
G A A | + | | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
A - T
A - T
G - C
C - G
T A
T A
A G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |