| Sequence ID | >SRA1046081 | 
| Genome ID | SRR035093.232419 | 
| Phylum/Class | 454 Sequencing (SRP001814) | 
| Species | |
| Start position on genome | 270 | 
| End posion on genome | 186 | 
| Amino Acid | Leu | 
| Anticodon | TAA | 
| Upstream region at tRNA start position | tggttatttT | 
| tRNA gene sequence | GCTGAGTTGTCCGAGTGGTCTAAGGAGGACGACTTAAGATCGTCTGTGCTACGCACGCGC | 
| Downstream region at tRNA end position | gcactcatag | 
| Secondary structure (Cloverleaf model) | >SRA1046081	Leu	TAA
                   T      ATtc gcactcatag
                     G - C
                     C - G
                     T - A
                     G - C
                     A - T
                     G - C
                     T   T          T A
                    T     C G C C C     A
      T G A        G      | | | | |     A
    G       G C C T       G C G G G     C
    G         | | |                 T T
    T       A G G A
      C T A        G     TGTGCTACGCACGC
                    G - C
                    A - T
                    C - G
                    G - C
                    A - T
                  C       A
                  T       G
                    T A A
 | 
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] | 
| Comment | |
| --- | |
| Input Comment |