Sequence ID | >SRA1046192 |
Genome ID | SRR035093.251413 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001814) |
Species | |
Start position on genome | 163 |
End posion on genome | 237 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgaggctccA |
tRNA gene sequence |
GCTCTTATGGTGTAGTTGGTCAACACTGTGGACTTTGAATCCACCACCCCAAGTTCAAGT |
Downstream region at tRNA end position |
tgttcctctc |
Secondary structure (Cloverleaf model) | >SRA1046192 Gln TTG A TTgt tgttcctctc G - C C - G T - A C - G T - A T + G A - T T G T G G T T C A T G A G | | | | | A T T G T G C C A A G C G | | | | T T G A C A C T C A T CACC G - C T - A G - C G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |