Sequence ID | >SRA1046266 |
Genome ID | SRR035093.266606 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001814) |
Species | |
Start position on genome | 303 |
End posion on genome | 375 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ataagaaggg |
tRNA gene sequence |
GCTCCCATGGTCTAGTGGTCATGACTAAGGTTTCTGATACCTTCAGCCCAAGTTCGATTC |
Downstream region at tRNA end position |
atatcacgcc |
Secondary structure (Cloverleaf model) | >SRA1046266 Gln CTG g TCgt atatcacgcc G - C C - G T - A C - G C - G C - G A - T T T T G G T T C A T G A G | | | | | G G T C T G C C A A G C G | | | T T T T G A C C A T CAGC A - T A - T G - C G - C T - A T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |