| Sequence ID | >SRA1046381 |
| Genome ID | SRR035093.293220 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 254 |
| End posion on genome | 168 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
tatttcattt |
| tRNA gene sequence |
GGCGCTATGTTGGAACTGGTAGACAAGACGGACTCAAAATCCGTTGTGAGCAATCATGTG |
| Downstream region at tRNA end position |
tctatttaat |
| Secondary structure (Cloverleaf model) | >SRA1046381 Leu CAA
t ACCA tctatttaat
G + T
G - C
C - G
G - C
C - G
T + G
A - T T G
T C T C T C A
C A A G | | | | | G
T G G T T G A G A G C
G | | | T T
G A C A A
T A G G TGTGAGCAATCATGT
A - T
C - G
G - C
G - C
A - T
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |