| Sequence ID | >SRA1046440 |
| Genome ID | SRR035093.307647 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 329 |
| End posion on genome | 245 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
tggttatttT |
| tRNA gene sequence |
GCTGAGTTGTCCGAGTGGTCTAAGGAGGACGACTTAAGATCGTCTGTGCTACGCACGCGC |
| Downstream region at tRNA end position |
gcactcatag |
| Secondary structure (Cloverleaf model) | >SRA1046440 Leu TAA
T ATtc gcactcatag
G - C
C - G
T - A
G - C
A - T
G - C
T T T A
T C G C C C A
T G A G | | | | | A
G G C C T G C G G G C
G | | | T T
T A G G A
C T A G TGTGCTACGCACGC
G - C
A - T
C - G
G - C
A - T
C A
T G
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |