Sequence ID | >SRA1046459 |
Genome ID | SRR035093.313301 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001814) |
Species | |
Start position on genome | 193 |
End posion on genome | 275 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
catttgctta |
tRNA gene sequence |
GCCCGAATGGCGGAACTGGTAGACGCACTCGTTTCAGGGACGAGCGCCGCAAGGTGTAGG |
Downstream region at tRNA end position |
aaatagctta |
Secondary structure (Cloverleaf model) | >SRA1046459 Leu CAG a ACat aaatagctta G - C C - G C - G C - G G - C A - T A - T T A T T C C T C A C A A G | | | | | G T G G C G A G G A G C G | | | T T G A C G C T A G A CGCCGCAAGGTGT C - G T - A C - G G - C T - A T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |