| Sequence ID | >SRA1046582 |
| Genome ID | SRR035093.336944 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 101 |
| End posion on genome | 177 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
agaatataat |
| tRNA gene sequence |
GGGGGCGTAGCTCAGTTGGTTAGAGTGCCTGCCTGTCACGCAGGATGTCGAGGGTTCGAG |
| Downstream region at tRNA end position |
tatatttgct |
| Secondary structure (Cloverleaf model) | >SRA1046582 Asp GTC
t GCCA tatatttgct
G - C
G - C
G - C
G + T
G - C
C - G
G - C T G
T T T C C C A
T G A A + | | | | G
T C T C G G A G G G C
G | | | + T T
G G A G T
T T A G ATGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |