Sequence ID | >SRA1046733 |
Genome ID | SRR035093.373001 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001814) |
Species | |
Start position on genome | 57 |
End posion on genome | 130 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
aagttgcacc |
tRNA gene sequence |
GTTCTTATAGCTCAGTTGGTTAGAGCGTAGTGCTTATAACGCTAAGGTCATGGGTTCGAG |
Downstream region at tRNA end position |
tttagagtga |
Secondary structure (Cloverleaf model) | >SRA1046733 Ile TAT c Atct tttagagtga G - C T - A T - A C - G T + G T T A - T C G T T G C C C A T G A A | + | | | G T C T C G A T G G G C G | | | | T T G G A G C T T A G AGGTC T - A A - T G - C T + G G - C C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |