| Sequence ID | >SRA1046869 |
| Genome ID | SRR035093.403678 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 343 |
| End posion on genome | 416 |
| Amino Acid | Tyr |
| Anticodon | GTA |
| Upstream region at tRNA start position |
gcttgttgtt |
| tRNA gene sequence |
CCTCTCTTAGCTCAGTTGGTAGAGCAATGGACTGTAGTTCCATTTGTCACCTGTTCGATT |
| Downstream region at tRNA end position |
ttttttctcc |
| Secondary structure (Cloverleaf model) | >SRA1046869 Tyr GTA
t ACat ttttttctcc
C - G
C - G
T - A
C - G
T - A
C - G
T - A T T
T T G G A C A
T G A A | | | | | G
T C T C G A C C T G C
G | | | | T T
G G A G C
T A A TTGTC
A - T
T - A
G - C
G - C
A - T
C T
T G
G T A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |