| Sequence ID | >SRA1047266 |
| Genome ID | SRR035093.497955 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 438 |
| End posion on genome | 362 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ttaattttta |
| tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAGTACACTCATAATGTATTGGTCCCAGGTTCGAG |
| Downstream region at tRNA end position |
aaaattattt |
| Secondary structure (Cloverleaf model) | >SRA1047266 Met CAT
a ACCA aaaattattt
G - C
G - C
G - C
C - G
C - G
T + G
A - T T G
T G G T C C A
T G A A | | | | | G
T C T C G C C A G G C
G | | | | T T
G G A G C
T T A A TGGTC
G + T
T - A
A - T
C - G
A - T
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |