| Sequence ID | >SRA1047448 |
| Genome ID | SRR035093.543789 |
| Phylum/Class | 454 Sequencing (SRP001814) |
| Species | |
| Start position on genome | 21 |
| End posion on genome | 96 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
gatcagcatg |
| tRNA gene sequence |
GTGGGTGTAGCTCAGCTGGTAGAGCGCTGCGTTGTGGTCGCAGATGCCGCGGGTTCAAGT |
| Downstream region at tRNA end position |
tgttttttct |
| Secondary structure (Cloverleaf model) | >SRA1047448 His GTG
g CCCA tgttttttct
G - C
T - A
G - C
G + T
G - C
T - A
G - C T G
T T G C C C A
C G A A + | | | | A
T C T C G G C G G G C
G | | | | T T
G G A G C
T A G ATGCC
C - G
T - A
G - C
C - G
G - C
T T
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |